Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c16842_457

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c16842_457
Contig
6BL_4262034
Probe
BobWhite_c16842_457
DNA Homology
6BL_4262034Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BL_4262034Best IWGSC match
DNA
ggcgccacctaccgccaggccaggccaggctagagggctataataacgcc
Rcctaccatgagctcaggctctcagcagctccaccttgtttgcatccatt
c
BLAST
BLAST Search