Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c17572_339

[Submit comment/correction]

Sequence
BobWhite_c17572_339
Contig
2DL_9882022
Probe
BobWhite_c17572_339
DNA Homology
2DL_9882022Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442DL_9882022Best IWGSC match
DNA
cggtgcaattgcaggtgtacccttggtcattggtggaatccacacacttg
Mtgttggcgctgaggcatgcgtaagtaccggttgtattctgttttgcagc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.