Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c19725_1329

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c19725_1329
Contig
3B_10520391
Probe
BobWhite_c19725_1329
DNA Homology
3B_10520391Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443B_10520391Best IWGSC match
DNA
acttcagctgtacatatcacggtaggtctggaatatttcccatgatgcac
Rccggcttgccacgaggtacgatcaacttcctcgaataaggccacggtgg
c
BLAST
BLAST Search