Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c1977_844

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c1977_844
Contig
6DL_495264
Species
Triticum aestivum
Probe
BobWhite_c1977_844
DNA
tagatgcagcatcgatcatggattgtctaaacacttcatggtcgacctcc
Rtatctgcaatctcttcctcgtctccctcaggcaccggtgaggggggatt
t
BLAST
BLAST Search