Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c2017_767

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c2017_767
Contig
7DS_3637130
Probe
BobWhite_c2017_767
DNA Homology
7DS_3637130Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-427DS_3637130Best IWGSC match
DNA
agagggctttcctcacatcctcgatcacgctgtgccttgtcgacagtttc
Rccactggagtagtcaccctggaagatcttggaagccgcgacacgctcat
c
BLAST
BLAST Search