Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c2288_723

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c2288_723
Contig
1DL_2233953
Probe
BobWhite_c2288_723
DNA Homology
1DL_2233953Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_2233953Best IWGSC match
DNA
caggcgatggacagagcacatcgtctgggccaaaggaaagttgtgaatgt
Rcaccgtctcatcatgcgcggcaccctggaggagaaagtgatgagtctcc
a
BLAST
BLAST Search