Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c23337_389

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c23337_389
Contig
5BL_10817779
Species
Triticum aestivum
Probe
BobWhite_c23337_389
DNA
CAAGTGTCCAGATTGCCTTCTAAGTGCTCTGATAAGAACACAATCAAGAA
YGGTGTAACAAGGTCGTTTATTCCTTGGACGTAGCCACTTGCAGGGTGCC
G
BLAST
BLAST Search