Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c23828_884

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c23828_884
Contig
6BS_1011973
Probe
BobWhite_c23828_884
DNA Homology
6BS_1011973Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446BS_1011973Best IWGSC match
DNA
actatgcgactgcatatgttttgctatttcctcatgtgcatacaacctct
Rtaatctatctttcagagggagatatctcaacactttacgtgggacttta
t
BLAST
BLAST Search