Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c23992_300

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c23992_300
Contig
5DS_2776385
Probe
BobWhite_c23992_300
DNA Homology
5DS_2776385Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DS_2776385Best IWGSC match
DNA
aaacccaagctaccgatggatccagagaaggacgacgccaccaaggtgac
Rctctcgggcctcctcaacttcattgatggactttggtctgcttgcgggg
g
BLAST
BLAST Search