Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c2822_228

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c2822_228
Contig
2BL_3929416
Probe
BobWhite_c2822_228
DNA Homology
2BL_3929416Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-422BL_3929416Best IWGSC match
DNA
cccccaccgcctcagcacgcacctgtcaatgttcactggactccggctcc
Rtctccctaccatgcttatccagccccctcggcctcgggttataatctat
c
BLAST
BLAST Search