Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c2963_1880

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c2963_1880
Contig
2BS_5177680
Probe
BobWhite_c2963_1880
DNA Homology
2BS_5177680Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442BS_5177680Best IWGSC match
DNA
ggggtgtggggaagatgagccatggaggaatttaccgagcttgggcatgc
Rcctgctggcctcctcatcagcctgattggcctttggcgctgatgagaaa
t
BLAST
BLAST Search