Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c30500_527

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c30500_527
Contig
6DL_3280185
Species
Triticum aestivum
Probe
BobWhite_c30500_527
DNA Homology
6DL_3280185Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446DL_3280185Best IWGSC match
DNA
ccgccaaagagctagacgtcccatatgtccagctttggacggccagcacc
Rttagctatctcggattccgttatttccgtctcctcattgaccgtggcat
t
BLAST
BLAST Search