Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c31621_148

Sequence
BobWhite_c31621_148
Contig
4AS_5999743
Species
Triticum aestivum
Probe
BobWhite_c31621_148
DNA
gcttcaaatcaatgaccagcgtttcgaggatgcggatgaagaggaggccc
Rtgaaaatgggcattagaagcagatatatgctcgttttactta
BLAST
BLAST Search