Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c344_125

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c344_125
Contig
6BS_2982553
Probe
BobWhite_c344_125
DNA Homology
6BS_2982553Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-426BS_2982553Best IWGSC match
DNA
agatttgggttcacctgtgggccgtactgagggtctctagtgatcaggtt
Rtgcctccccgcagcaagagcaaacgctggaagaagcataaacagcagcg
g
BLAST
BLAST Search