Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c3541_152

[Submit comment/correction]

Sequence
BobWhite_c3541_152
Contig
7BL_6739552
Probe
BobWhite_c3541_152
DNA Homology
7BL_6739552Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BL_6739552Best IWGSC match
DNA
gtcgtaatgacagttacagacttgcagaactataatgaactgaagcaaac
Racagttcaactgaaactacatttacattcatccaggtatttcaaaataa
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.