Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c35701_185

[Submit comment/correction]

Sequence
BobWhite_c35701_185
Contig
7AS_4214532
Probe
BobWhite_c35701_185
DNA Homology
7AS_4214532Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-417AS_4214532Best IWGSC match
DNA
accagaccgctcagctcgacatcgaggcaaccttccgcatcgatgcctcc
Rccattgaggccctcaacgaggccgatgtcagctacaattgcaccaccag
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.