Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c36118_246

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c36118_246
Contig
3B_10762072
Probe
BobWhite_c36118_246
DNA Homology
3B_10762072Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-423B_10762072Best IWGSC match
DNA
cgcttgcagaatgcttgcctgcgttgtgagctgaatccgcagggatgccc
Rtttcgctcgcagtctagacaaatgtcggttatgttaggaactgaccaag
t
BLAST
BLAST Search