Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c3714_659

[Submit comment/correction]

Sequence
BobWhite_c3714_659
Contig
6AS_4359133
Probe
BobWhite_c3714_659
DNA Homology
6AS_4359133Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AS_4359133Best IWGSC match
DNA
gcgagtttcgcttcgctgcataatgtcaccacgtttcttcatgttacacg
Rcaattccagaacatccaccaaacaagcacaataacagtcacatcttctt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.