Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c38419_677

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c38419_677
Contig
2DL_9842556
Species
Triticum aestivum
Probe
BobWhite_c38419_677
DNA
GGAGCCTGCCCTGTGCTCGATCCGTCGTAGTTCCATTTCGGTAGCTCTGA
Ygggtcctccactggctttgaaatcgtccttgatttgctcctgaggtcaa
t
BLAST
BLAST Search