Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c40051_360

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c40051_360
Contig
6AL_5812413
Species
Triticum aestivum
Probe
BobWhite_c40051_360
DNA Homology
6AL_5812413Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-446AL_5812413Best IWGSC match
DNA
gactccaacttctgtgaacgtgccaatgcagccaacccatcatctgtcac
Rctactacattcccggagtgtgaggtgactcaaacaaggagcctgagcaa
t
BLAST
BLAST Search