Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c40583_146

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c40583_146
Contig
7AS_4217398
Probe
BobWhite_c40583_146
DNA Homology
7AS_4217398Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-427AS_4217398Best IWGSC match
DNA
gtctgaaaaggatgtagtggcgtcctagacgggtgcattggtgtttcact
Rcccaacgaaaatcggggctcactggtaataataagtcctgttagtaatt
g
BLAST
BLAST Search