Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c4126_442

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c4126_442
Contig
1BL_3868171
Species
Triticum aestivum
Probe
BobWhite_c4126_442
DNA
accagatcaacgacctcctcctcggcttcctcaaggaccatccctgatct
Rtaatccatcaacggacgagagtgagctccgggccaacgaataaagcatc
c
BLAST
BLAST Search