Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c4142_91

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c4142_91
Contig
2BL_8058274
Probe
BobWhite_c4142_91
DNA Homology
2BL_8058274Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-422BL_8058274Best IWGSC match
DNA
tattagtgctgacaagttctgcctgaaagccttgcaggtcccttggtaac
Rggatgaggcagcaacctatcccattacaaggccctccagttgctgcctt
c
BLAST
BLAST Search