Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c43_86

[Submit comment/correction]

Sequence
BobWhite_c43_86
Contig
5BL_10924717
Probe
BobWhite_c43_86
DNA Homology
5BL_10924717Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10924717Best IWGSC match
DNA
attgctattcacaactcattcgagttcagcttcaacaatacaacattctg
Rttcaaaattacaaaaaagttacaatgtcggcgatcatcgccatggcgcc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.