Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c44364_145

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c44364_145
Contig
3DS_704729
Probe
BobWhite_c44364_145
DNA Homology
3DS_704729Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-423DS_704729Best IWGSC match
DNA
taatgaatacccctggcaatgcctaaagcaatctccatgagcttgtccca
Rcagaaactcttcttggctgagaagatgtatttgtccaaagaacctcgag
g
BLAST
BLAST Search