Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c46361_331

[Submit comment/correction]

Sequence
BobWhite_c46361_331
Contig
3AL_4391858
Probe
BobWhite_c46361_331
DNA Homology
3AL_4391858Best IWGSC match1321e-28URGI_BestIWGSC_N
BLAST, e-value
1e-283AL_4391858Best IWGSC match
DNA
gcgcgtcgggcacggcgtcgggacaggaatgtacataccgcgcatgatgt
Rctttggaagctcatcttccttgtgaaattgtcgttgatgttcagatctg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.