Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c4838_58

[Submit comment/correction]

Sequence
BobWhite_c4838_58
Contig
5DS_2761302
Species
Triticum aestivum
Probe
BobWhite_c4838_58
DNA
catcgggtctccttcggcgacctcccgttgcggcagttcctaacgtagcg
Rtcattgtccgccgggcgttgctttgctggcgagctagacagcvhcvhca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.