Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c5689_279

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c5689_279
Contig
4BS_4903855
Species
Triticum aestivum
Probe
BobWhite_c5689_279
DNA
TGCTTAATGTGCAGCAAACCGTGCAAAGAGAGGAATTTGATTAATTTAGA
RAAAGGAGGAACGGGTTTCGCTGCACACGATGACCACCTAGAGGCAAAGA
A
BLAST
BLAST Search