Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c6759_365

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_c6759_365
Contig
5DL_4470001
Probe
BobWhite_c6759_365
DNA Homology
5DL_4470001Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445DL_4470001Best IWGSC match
DNA
agagattgagttctagacgatcacaggatcactgataatcaccaaggccc
Rtatttttgtacataagaaaagtatggcgagtgaagctcctaagctaacg
g
BLAST
BLAST Search