Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_c8674_595

Sequence
BobWhite_c8674_595
Contig
3AL_4447586
Probe
BobWhite_c8674_595
DNA Homology
3AL_4447586Best IWGSC match1435e-32URGI_BestIWGSC_N
BLAST, e-value
5e-323AL_4447586Best IWGSC match
DNA
tatccaggggttcttctaccaactaaaatggatgccagtatatcatcatc
Rttaggaatagcatcagtggttctttgaccatctggtgtgctggacaaat
t
BLAST
BLAST Search