Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c49306_196

[Submit comment/correction]

Sequence
BobWhite_rep_c49306_196
Contig
3B_10637948
Species
Triticum aestivum
Probe
BobWhite_rep_c49306_196
DNA
cgctgccatctccatcctgccggagctcgccttgtgggtggcggtggcgg
Mgacgaggagggtggcgccggcggcctcgacctcagggtacatgttgcag
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.