Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c49367_405

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c49367_405
Contig
7AL_4553175
Probe
BobWhite_rep_c49367_405
DNA Homology
7AL_4553175Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447AL_4553175Best IWGSC match
DNA
ctcagagccatctttgcttccagcaacgcaaagttctggccgatgcagat
Mcgaggaccccctccaaacgggaagaacgccgccggatgctttgccgcat
t
BLAST
BLAST Search