Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c49374_295

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c49374_295
Contig
3AS_3346775
Probe
BobWhite_rep_c49374_295
DNA Homology
3AS_3346775Best IWGSC match1611e-37URGI_BestIWGSC_N
BLAST, e-value
1e-373AS_3346775Best IWGSC match
DNA
tcaagttttgtggattccatcgacttaagatcaagcatgtaggcactgtc
Mtcaacatacagaatgatcacattgctggcttcgtcataccccaggattt
t
BLAST
BLAST Search