Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c50145_387

[Submit comment/correction]

Sequence
BobWhite_rep_c50145_387
Contig
5AS_1507050
Probe
BobWhite_rep_c50145_387
DNA Homology
5AS_1507050Best IWGSC match1359e-30URGI_BestIWGSC_N
BLAST, e-value
9e-305AS_1507050Best IWGSC match
DNA
agggctcaagacatgtctcatttgttggatctaaggaaagcaggtgcgac
Mgatgttgttctggaaaatgctgagactagcttgcaactcggctcgatgc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.