Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c50186_469

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c50186_469
Contig
2DL_739916
Probe
BobWhite_rep_c50186_469
DNA Homology
2DL_739916Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-442DL_739916Best IWGSC match
DNA
aagggtgagtgtgccagtcttatcactgcaaagcacatccatgccagcca
Rctcttcaatggcagtcatcctcttggtgatagcaccctgctgggacaac
t
BLAST
BLAST Search