Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c50492_500

[Submit comment/correction]

Sequence
BobWhite_rep_c50492_500
Contig
3B_10758266
Species
Triticum aestivum
Probe
BobWhite_rep_c50492_500
DNA Homology
3B_10758266Best IWGSC match1651e-38URGI_BestIWGSC_N
BLAST, e-value
1e-383B_10758266Best IWGSC match
DNA
tcaaagacacgagagagagagagggagagagaatgaaactaaactggctt
Rctgatgatgacacgacgacgtacacttgctggaattttttgaatcgatt
t
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.