Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c50999_270

Sequence
BobWhite_rep_c50999_270
Contig
6DL_3312441
Species
Triticum aestivum
Probe
BobWhite_rep_c50999_270
DNA
TAGGCACGTGCCTGCCCGCAAATGAGACCACAGCTTGCTCACCAATCGCC
Rtgccaccgtcaccatcctctcattgacttgaagccagacttgttattag
t
BLAST
BLAST Search