Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c63088_181

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c63088_181
Contig
3AS_3439990
Probe
BobWhite_rep_c63088_181
DNA Homology
3AS_3439990Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-443AS_3439990Best IWGSC match
DNA
cggaactcggctacgacaccgaccccgaaacgaagaggacgatcgatcgc
Rtcgccgaggtggccttccagtgcttgcagctcgagagggatctgaggcc
g
BLAST
BLAST Search