Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c65082_84

[ Printable Version ]  [ Submit comment/correction ]

Sequence
BobWhite_rep_c65082_84
Contig
2BS_5191753
Species
Triticum aestivum
Probe
BobWhite_rep_c65082_84
DNA
gctatcgcctccccacctagcaattcacgtactccgccatggctcccgcc
Rtgatggcttcctccgccaccaccgtcgcgcccttccaggggctcaagtc
g
BLAST
BLAST Search