Query (optional)   in Class  

GrainGenes Sequence Report: BobWhite_rep_c67379_385

[Submit comment/correction]

Sequence
BobWhite_rep_c67379_385
Contig
5AS_1518371
Probe
BobWhite_rep_c67379_385
DNA Homology
5AS_1518371Best IWGSC match1764.99983e-42URGI_BestIWGSC_N
BLAST, e-value
4.99983e-425AS_1518371Best IWGSC match
DNA
aacaccgagctgcggaagctcttcattgagaccacgggcaagtccatcat
Mgtcatagaggacatcgactgctcgatcgacctcaccggaaaacgcccgc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.