Query (optional)   in Class  

GrainGenes Sequence Report: CA624127

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CA624127
Contig
TaAffx.132322.1.S1_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC359981
NCBI UniGene
Ta.48623
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_001047524.1 Os02g0636600 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Clone Library
wl1n
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
wl1n.pk0115.f2 wl1n Triticum aestivum cDNA clone wl1n.pk0115.f2 5' end, mRNA sequence.
Clone
wl1n.pk0115.f2
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Scott V. Tingey; Crop Genetics; E. I. DuPont de Nemours and Company; 1 Innovation Way, P.O. Box 6104, Newark, DE 19714-6104, USA; Tel: 302-631-2602; Fax: 302-631-2607; Email: Scott.V.Tingey@USA.dupont.com; Seq primer: M13.
Note: Vector: pBluescript SK+; Site_1: EcoRI; Site_2: XhoI; Wheat (Triticum aestivum L.) leaf 7 day old seedling , light grown (normalized)
Note: Vector: pBluescript SK+; Site_1: EcoRI; Site_2: XhoI; Wheat (Triticum aestivum L.) leaf 7 day old seedling, light grown (normalized)
DNA
cgccgacaacccagagcagaagtacatacacatggccaccgtggacgggt
tcgagttctggttcatgggcttcgtgagctaccagaggtgctgcaagtac
atgcagcaggtcatctcgtcccagttgtgatggcaatagctaaaagtgaa
cgtcttgtgggcttcctgccgcaacgtcttgttggagcgcgcgcagccga
gaacctctgctccaccatttttttgatgagagcatgttccgattggaatt
tacagatgtgcctattgcaatttctgtttgtaggaccgaggaacttggtc
tgaatgaaaattatttattttggggggg
BLAST
BLAST Search