Query (optional)   in Class  

GrainGenes Sequence Report: CA730992

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CA730992
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC332262
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Clone Library
wip1c
Tissue
pistils
Data Source
genbankRelease 135, Apr 15 2003
genbankUpdated Nov 2006
Title
wip1c.pk006.o11 wip1c Triticum aestivum cDNA clone wip1c.pk006.o11 5' end, mRNA sequence.
Strain
lab_host DH10B
Clone
wip1c.pk006.o11
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Scott V. Tingey; Crop Genetics; E. I. DuPont de Nemours and Company; 1 Innovation Way, P.O. Box 6104, Newark, DE 19714-6104, USA; Tel: 302-631-2602; Fax: 302-631-2607; Email: Scott.V.Tingey@USA.dupont.com; Seq primer: M13.
Note: Vector: pBluescript SK+; Site_1: EcoRI; Site_2: XhoI; Wheat (Triticum aestivum, Hi Line) immature pistils
DNA
gcacgaggccaactccagccgccgccacacactccccgcagccaatcctc
cccaacccaagctcgcagccatgcctcccaagctcgacccgtcccagatc
gtggaggtgtatgtccgcgtcaccggcggggaggtcggcgctgcgtcgtc
cctggcccccaagatcggtccgctcggtctctccccaaagaagatcggag
aagacatcgccaaggagacggccaaggactggaagggcctccgcgtcacc
gtcaagctcaccgtccagaatcgccaggccaaggtgtccgtcgtcccctc
cgccgcagccctcgtcatcaaggcgctcaaggagcccgagagggaccgca
agaaggtcaagaacatcaagcacagcggcaacatcagcctcgacgacgtc
atcgagatcgccaagatcatgaaggtccgctccatggccaaggagatggc
cggcaccgtcaaggagatcctcggcacctgcgtcagcgtcggctgcaccg
ttgacggcaaggaccccaaggatctgcagacggagatcgacgacggcgag
gtggagatccccgcttaagaaggcttggctttgggcaggttgttatgtga
ggctgctgaagtagtttctcctnnn
BLAST
BLAST Search