Query (optional)   in Class  

GrainGenes Sequence Report: CAP12_c3602_91

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CAP12_c3602_91
Contig
1AL_1065975
Probe
CAP12_c3602_91
DNA Homology
1AL_1065975Best IWGSC match1651e-38URGI_BestIWGSC_N
BLAST, e-value
1e-381AL_1065975Best IWGSC match
DNA
catcaggatgctgttagaacctgaggccacaactgtcagctattcctttg
Rcattactgtatttccatggtgacttgtggctatttcattcgtgaccttt
t
BLAST
BLAST Search