Query (optional)   in Class  

GrainGenes Sequence Report: CAP12_c3699_80

[Submit comment/correction]

Sequence
CAP12_c3699_80
Contig
2DS_5047857
Probe
CAP12_c3699_80
DNA Homology
2DS_5047857Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-412DS_5047857Best IWGSC match
DNA
gggatcgaatgcggcaaggggcagaacgacaaggtggccgatcggatcgg
Rttctacaagcgctattgtgacatcttcggcatcggctacgggaataacc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.