Query (optional)   in Class  

GrainGenes Sequence Report: CAP12_c4100_640

[Submit comment/correction]

Sequence
CAP12_c4100_640
Contig
1BL_3879368
Probe
CAP12_c4100_640
DNA Homology
1BL_3879368Best IWGSC match1503e-34URGI_BestIWGSC_N
BLAST, e-value
3e-341BL_3879368Best IWGSC match
DNA
gaaccagctttgaaccatacagcctcgccgaacttgacgccgttgcgagc
Ragaagctctgggaagacgcatccgagagcaccgagcatggcccaccggc
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.