Query (optional)   in Class  

GrainGenes Sequence Report: CAP12_c4778_199

[Submit comment/correction]

Sequence
CAP12_c4778_199
Contig
3B_10764436
Probe
CAP12_c4778_199
DNA Homology
3B_10764436Best IWGSC match1781.00053e-42URGI_BestIWGSC_N
BLAST, e-value
1.00053e-423B_10764436Best IWGSC match
DNA
atccagcgcacgaacagaagcgcaagtggactcctcgtgctgctgaaact
Raaagcgtatactactggaagtagacgggcagatgatcacccacccacgg
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.