Query (optional)   in Class  

GrainGenes Sequence Report: CAP7_c1737_105

[Submit comment/correction]

Sequence
CAP7_c1737_105
Contig
7AL_4444276
Probe
CAP7_c1737_105
DNA Homology
7AL_4444276Best IWGSC match1727.00005e-41URGI_BestIWGSC_N
BLAST, e-value
7.00005e-417AL_4444276Best IWGSC match
DNA
cggaggtgtcgacgctgccgtggtcgctcttcacaaagtccccgcggcgg
Mggatgcgggtggccttcacctgcaacgtctgcgggcagcgcacaactcg
c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.