Query (optional)   in Class  

GrainGenes Sequence Report: CAP7_c4304_358

[Submit comment/correction]

Sequence
CAP7_c4304_358
Contig
7DS_3845763
Probe
CAP7_c4304_358
DNA Homology
7DS_3845763Best IWGSC match1359e-30URGI_BestIWGSC_N
BLAST, e-value
9e-307DS_3845763Best IWGSC match
DNA
ggcattgcgtctcgacaaaggcatgtatagtcgatgctagttttgtacat
Rtggcttgacagaggactggaacagactctttatatacatgttacaaaca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.