Query (optional)   in Class  

GrainGenes Sequence Report: CD452868

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CD452868
Contig
Ta.26128.1.A1_at
NSFT03P2_Contig7003
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC296271
wEST map position
CD452868
NCBI UniGene
Ta.26128
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, weakly similar to NP_001058619.1 Os06g0725100 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
7AL
7BL
7DL
Clone Library
CS wheat etiolated seedling root normalized cDNA library
Tissue
Root
Developmental Stage
Five day old etiolated seedling
Data Source
genbankRelease 136, Jun 15 2003
genbankUpdated Nov 2006
Title
WHE1135_A05_B09ZT CS wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1135_A05_B09, mRNA sequence.
Strain
lab_host E. coli DH10B
Clone
WHE1135_A05_B09
Probe
MAG1808
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer.
Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares'. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tttttttttttttttttttcaaaccgaagagaacaatcatgtctcgtact
aattttcaaggaatcaatcaatcatctctgatgggctagctccttgaagc
tgatgggtgtggtgatctgtgtcggcccgtccacgaagagcgcctgcgca
cccagctcagcggcccgctggctggggtgcacgttgtcaaagaaagcgta
cacatcgcggtcgctgcacactgtcgcgttcctcatgcactcaccctccg
cgcccagcctaccgctcccgcagcatgcgctatcggcgttcacgaacccg
gccgcttgtgggttgtcgaagttggcccgcgtgccggcgaaggagtcggc
gagggagtatgcgaggcctgggagcctcgttgggctgagggctgcagcga
ggccagacttgaacgccgcggcgagcccgacagtgaggcggttcatgcca
tcgttgcaggcacccgtcgcgttcaacaggcgcacccgcggcacacaccc
cactgggccagggctgatgatccccaattttctcgcgcccatcccataca
gttcggtgatggcggcggagtagttcgagacgagggtggcatagagtccg
gcaacatcggcttgggactttggtctgctctggaagaggtcgttgctgcc
gaancccaggaggaagaaggagctggcgaggagcttggagactttatgtc
tgccccacacggcctccatctcggccttggtcgacgcgaagtagctcacc
tgctttgacc
BLAST
BLAST Search