Query (optional)   in Class  

GrainGenes Sequence Report: CD936281

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CD936281
Contig
Ta.30803.1.S1_at
Ta.30803.1.S1_x_at
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC340560
NCBI UniGene
Ta.54141
DB Remark
Locus Source: Triticum aestivum (bread wheat)
UniGene title 'Transcribed locus, strongly similar to NP_200875.1 60S ribosomal protein L12 (RPL12C) [Arabidopsis thaliana]'
Keyword
EST
Species
Triticum aestivum
Cultivar
recital
Clone Library
OV
Tissue
ovary
Data Source
genbankRelease 137, Aug 15 2003
genbankUpdated Nov 2006
Title
OV.104E19R010430 OV Triticum aestivum cDNA clone OV104E19, mRNA sequence.
Clone
OV104E19
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'mRNA';
Locus Comment: Contact: Genoplante; Genoplante; 93, rue Henri Rochefort 91025 EVRY CEDEX France; Tel: 33 1 69 47 54 00; Fax: 33 1 69 47 54 10; This sequence has been generated in the framework of the french; plant genomics programme 'Genoplante' (http:
DNA
gcagcaactaacaatatataagaaacgctcaaaagatcattgacaaaact
caacatatgatattctagctgccataataacattgattgattccggaagg
tactcattaaagcagtaaaaatagtctcacaatggaaccactaaagcatg
acaaaagtttcttcttccgcaagagtagaacaagtgaagacatcacatcc
attctctcaactggaggaggaagcatctagataggagaaactacttcagc
agcctcacataacaacctccccaaagccaagccttcttaagcggggatct
ccacctcgccgtcgtcgatctccgtctgcagatccttggggtccttgccg
tcgacggtgcagccgacgctgacgcaggtgccgaggatctccttgacggt
gccggccatctccttggccatggagcggaccttcatgatcttggcgatct
cgatgacgtcgtcgaggctgatgttgccgttgtgcttgatgttcttgacc
ttcttgcggtccctctcgggctccttgagcgccttgatgacgagggctgc
ggcggaggggacgacggacaccttggcctggcgattctggacggtgagct
tgacggtgacgcggaggcccttccagtccttggccgtctccttggcgatg
tcttctccgatcttctttgcggagcagacca
BLAST
BLAST Search